View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18018_high_29 (Length: 223)
Name: NF18018_high_29
Description: NF18018
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18018_high_29 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 173; Significance: 3e-93; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 43 - 223
Target Start/End: Complemental strand, 23011338 - 23011158
Alignment:
| Q |
43 |
aactattcacatgattctattgtcagaattcctttggttcgatggcggatgttgcaatttcgatcgtggctactgtggttgaacgtttggtgggaccagc |
142 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23011338 |
aactattcacatgattctattgtcagaatacctttggttcgatggcggatgttgcaatttcgatcgtggctactgtggttgaacgtttggtgggaccagc |
23011239 |
T |
|
| Q |
143 |
aatacgcgaaggaaaatgtgttctttgcgttaataagttcattggcgatcttgagaatgaaaagaaggagctggtattcga |
223 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23011238 |
aatacgcgaaggaaaatgtgttctttgtgttaataagttcattggcgatcttgagaatgaaaagaaggagctggtattcga |
23011158 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University