View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18018_low_27 (Length: 234)
Name: NF18018_low_27
Description: NF18018
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18018_low_27 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 126; Significance: 4e-65; HSPs: 4)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 18 - 215
Target Start/End: Original strand, 42861454 - 42861651
Alignment:
| Q |
18 |
tataacttgattaaagcttataactctttcctccttcnnnnnnnnnnnnnnnncagaaagcttataactatttcccttctttactaggaactgacaattc |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42861454 |
tataacttgattaaagcttataactctttcctccttcaaaaaaaaaaaaaaaacagaaagcttataactatttcccttctttactaggaactgacaattc |
42861553 |
T |
 |
| Q |
118 |
attgtgtcnnnnnnnngcaggtgttacaattatctactgaaactcccaaggattctgatatggacactgttagtgggagcatttattcgactgatcaa |
215 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42861554 |
attgtgtcttttttttgcaggtgttacaattatctactgaaactcccaaggattctgatatggacactgttagtgggagcatttattcgactgatcaa |
42861651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 80 - 121
Target Start/End: Original strand, 42857176 - 42857217
Alignment:
| Q |
80 |
tataactatttcccttctttactaggaactgacaattcattg |
121 |
Q |
| |
|
|||||||||||||||||||||||||||| || |||||||||| |
|
|
| T |
42857176 |
tataactatttcccttctttactaggaattgtcaattcattg |
42857217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 77 - 121
Target Start/End: Original strand, 42855597 - 42855641
Alignment:
| Q |
77 |
gcttataactatttcccttctttactaggaactgacaattcattg |
121 |
Q |
| |
|
|||||||||| |||||||||||||||||||| || |||||||||| |
|
|
| T |
42855597 |
gcttataactctttcccttctttactaggaattgtcaattcattg |
42855641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 77 - 121
Target Start/End: Original strand, 42848954 - 42848998
Alignment:
| Q |
77 |
gcttataactatttcccttctttactaggaactgacaattcattg |
121 |
Q |
| |
|
|||||||| | |||||||||||||||||||| || |||||||||| |
|
|
| T |
42848954 |
gcttataattctttcccttctttactaggaattgtcaattcattg |
42848998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University