View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18018_low_28 (Length: 227)
Name: NF18018_low_28
Description: NF18018
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18018_low_28 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 14 - 209
Target Start/End: Original strand, 45887706 - 45887901
Alignment:
| Q |
14 |
cagagaccatagaatcgtcactttcatcatcttctggatcagcttgatgagtagttccttcatcatccatgatgttatcaatatctccatcattatcatc |
113 |
Q |
| |
|
|||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45887706 |
cagaaaccatagaatcatcactttcatcatcttctggatcagcttgatgagtagttccttcatcatccatgatgttatcaatatctccatcattatcatc |
45887805 |
T |
 |
| Q |
114 |
ttctatgtgggacccaatatacatggtccatccagattcactgctttcacattcctcttcacttccaaagattttggatggtttcatcctaaaggc |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45887806 |
ttctatgtgggacccaatatacatggtccatcccgattcactgctttcacattcctcttcacttccaaagattttggatggtttcatcctaaaggc |
45887901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 127 - 177
Target Start/End: Complemental strand, 24309554 - 24309504
Alignment:
| Q |
127 |
ccaatatacatggtccatccagattcactgctttcacattcctcttcactt |
177 |
Q |
| |
|
||||||||||||||||||||||||||||| || | |||||||||||||||| |
|
|
| T |
24309554 |
ccaatatacatggtccatccagattcactactatgacattcctcttcactt |
24309504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University