View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18019_high_10 (Length: 237)
Name: NF18019_high_10
Description: NF18019
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18019_high_10 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 19 - 223
Target Start/End: Complemental strand, 32992407 - 32992198
Alignment:
| Q |
19 |
tattatttattatacttcaatttttctaactcgttcgtctcataataagtgacatatttgagatgtttataatgaga-cgggagagtaatagataaaaag |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
32992407 |
tattatttattatacttcaatttttctaactcgttcgtctcataataagtgacatatttgagatgcttataatgagatggggagagtaatagataaaaag |
32992308 |
T |
 |
| Q |
118 |
aagtaaaaagaaaatcacttgaaccaaccgtggataccgattcaaaccaattcaatctg----gttcaaacaaactgaagatcaaacaaactagtgaacc |
213 |
Q |
| |
|
||||| |||||||||| ||||| ||||||||||||| |||||||||||||||||||||| |||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
32992307 |
aagtacaaagaaaatcgcttgagccaaccgtggatatcgattcaaaccaattcaatctggttcgttcaaccaaactgaagatcaaaccaactagtgaacc |
32992208 |
T |
 |
| Q |
214 |
ggttggttct |
223 |
Q |
| |
|
|||||||||| |
|
|
| T |
32992207 |
ggttggttct |
32992198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University