View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18020_high_13 (Length: 300)
Name: NF18020_high_13
Description: NF18020
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18020_high_13 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 259; Significance: 1e-144; HSPs: 6)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 12 - 282
Target Start/End: Original strand, 25324986 - 25325256
Alignment:
| Q |
12 |
gaagaatataacggcgtagattgagtaatagatgcaccagaaccaatgtaatctgcagcacatgttggtgatgaggtttttgaatttttcttgtgatgat |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
25324986 |
gaagaatataacggcgtagattgagtaatagatgcaccagaaccaatgaaatctgcagcacatggtggtgatgaggtttttgaatttttcttgtgatgat |
25325085 |
T |
|
| Q |
112 |
taggttttgttgttgatgaattttatggtacaaagttgtgtgcttttatagggtggaaatagatggatttttgggtatagtgtggttcttgtgattttct |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25325086 |
taggttttgttgttgatgaattttatggtacaaagttgtgtgcttttatagggtggaaatagatggatttttgggtatagtgtggttcttgtgattttct |
25325185 |
T |
|
| Q |
212 |
aggtgatttcgttgcaatatgtagtacattagagagaagctagtagcattgacttttgaagcctaactctt |
282 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25325186 |
aggtgatatcgttgcaatatgtagtacattagagagaagctagtagcattgacttttgaagcctaactctt |
25325256 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 12 - 282
Target Start/End: Original strand, 26154679 - 26154949
Alignment:
| Q |
12 |
gaagaatataacggcgtagattgagtaatagatgcaccagaaccaatgtaatctgcagcacatgttggtgatgaggtttttgaatttttcttgtgatgat |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
26154679 |
gaagaatataacggcgtagattgagtaatagatgcaccagaaccaatgaaatctgcagcacatggtggtgatgaggtttttgaatttttcttgtgatgat |
26154778 |
T |
|
| Q |
112 |
taggttttgttgttgatgaattttatggtacaaagttgtgtgcttttatagggtggaaatagatggatttttgggtatagtgtggttcttgtgattttct |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26154779 |
taggttttgttgttgatgaattttatggtacaaagttgtgtgcttttatagggtggaaatagatggatttttgggtatagtgtggttcttgtgattttct |
26154878 |
T |
|
| Q |
212 |
aggtgatttcgttgcaatatgtagtacattagagagaagctagtagcattgacttttgaagcctaactctt |
282 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26154879 |
aggtgatatcgttgcaatatgtagtacattagagagaagctagtagcattgacttttgaagcctaactctt |
26154949 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 76 - 165
Target Start/End: Complemental strand, 25442318 - 25442230
Alignment:
| Q |
76 |
ttggtgatgaggtttttgaatttttcttgtgatgattaggttttgttgttgatgaattttatggtacaaagttgtgtgcttttatagggt |
165 |
Q |
| |
|
|||||||| |||||||||||||||| |||||||| | ||||||||| || ||||||||||||||||||||||||||| |||||| ||||| |
|
|
| T |
25442318 |
ttggtgataaggtttttgaattttt-ttgtgatggtgaggttttgtggtggatgaattttatggtacaaagttgtgtacttttaaagggt |
25442230 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 76 - 159
Target Start/End: Complemental strand, 25434419 - 25434333
Alignment:
| Q |
76 |
ttggtgatgaggtttttgaatttttct---tgtgatgattaggttttgttgttgatgaattttatggtacaaagttgtgtgctttta |
159 |
Q |
| |
|
||||||||||||||||||||||||| | ||||||||| ||||||||| |||||||||||||||||||| ||||| ||| |||||| |
|
|
| T |
25434419 |
ttggtgatgaggtttttgaatttttttctttgtgatgatgaggttttgtggttgatgaattttatggtacgaagttatgtactttta |
25434333 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 155 - 231
Target Start/End: Complemental strand, 25321866 - 25321790
Alignment:
| Q |
155 |
ttttatagggtggaaatagatggatttttgggtatagtgtggttcttgtgattttctaggtgatttcgttgcaatat |
231 |
Q |
| |
|
||||| ||||||||||| | | ||||||||||||| ||||| | ||| || |||||||||||||||||||||||||| |
|
|
| T |
25321866 |
ttttaaagggtggaaattggtagatttttgggtatggtgtgttgcttttgcttttctaggtgatttcgttgcaatat |
25321790 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 155 - 231
Target Start/End: Complemental strand, 26151559 - 26151483
Alignment:
| Q |
155 |
ttttatagggtggaaatagatggatttttgggtatagtgtggttcttgtgattttctaggtgatttcgttgcaatat |
231 |
Q |
| |
|
||||| ||||||||||| | | ||||||||||||| ||||| | ||| || |||||||||||||||||||||||||| |
|
|
| T |
26151559 |
ttttaaagggtggaaattggtagatttttgggtatggtgtgttgcttttgcttttctaggtgatttcgttgcaatat |
26151483 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University