View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18020_high_20 (Length: 239)
Name: NF18020_high_20
Description: NF18020
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18020_high_20 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 19 - 229
Target Start/End: Complemental strand, 25814206 - 25813996
Alignment:
| Q |
19 |
gtacttcacttctttcaggaaccaatccacttccaagtcaagacgacaattaatgcaagtgtcgaattcgtagtcctcatctgaattcgcccaccaaaga |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25814206 |
gtacttcacttctttcaggaaccaatccacttccaagtcaagacgacaattaatgcaagtgtcgaattcgtagtcctcatctgaattcgcccaccaaaga |
25814107 |
T |
|
| Q |
119 |
cctttctttagttgtggttctttgcatgcttcaaattgatcaacacatacctttgagtataccaaattatttggccacgatcttcttagtacccagtatc |
218 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
25814106 |
cctttctttagttgttgttctttgcatgcttcaaattgatcaacacatacctttgagtataccaaattatttggccacgatcttcttagtactcagtatc |
25814007 |
T |
|
| Q |
219 |
catcagaatta |
229 |
Q |
| |
|
||||||||||| |
|
|
| T |
25814006 |
catcagaatta |
25813996 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University