View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18020_high_23 (Length: 226)
Name: NF18020_high_23
Description: NF18020
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18020_high_23 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 11 - 212
Target Start/End: Complemental strand, 2448156 - 2447950
Alignment:
| Q |
11 |
cataggcaatcaaataagaaaccctatatctattcaacaacattacatgagaggtggagaacaggttaatattttttctcccttacttcatgttgattg- |
109 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2448156 |
catagtcaatcaaataagaaaccctatatctattcaacaacattacatgagaggtggagaacaggttaatattttttctcccttacttcatgttgattga |
2448057 |
T |
 |
| Q |
110 |
----attttgttaatgaataataatatgcctaaattttgcttttacnnnnnnnattgcagaaggacgcagtaaaagtgagtgatgtaacatttagtaata |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2448056 |
tttgattttgttaatgaataataatatgcctaaattttgcttttactttttttattgcagaaggacgcagtaaaagtgagtgatgtaacatttagtaata |
2447957 |
T |
 |
| Q |
206 |
tatatgg |
212 |
Q |
| |
|
| ||||| |
|
|
| T |
2447956 |
tctatgg |
2447950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University