View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18020_low_21 (Length: 243)
Name: NF18020_low_21
Description: NF18020
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18020_low_21 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 20 - 233
Target Start/End: Original strand, 38360012 - 38360225
Alignment:
| Q |
20 |
ttttggacatcataaggatagctgaaagaaattggtccccgcattgtagattggttgctctatctgccataattcacttcttcaacaccaactggttttg |
119 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||| || |||||| ||||||||||||||||||||||||||| ||||||||||| ||||||||| |
|
|
| T |
38360012 |
ttttggacatcataaggatagctaaaagaaattggtccccacaatgtagactggttgctctatctgccataattcactgcttcaacaccatctggttttg |
38360111 |
T |
 |
| Q |
120 |
cataaaccaaagaagatttaatgctaagataatcaatgtcagatatgttgtcaacatggttatctcaggtgcttctcgttctggcaacaactcacttata |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| || |
|
|
| T |
38360112 |
cataaaccaaagaagatttaatgctaagataatcaatgtcagatatgttgtcaacatggttatctcaggtgcttcttgttctggcaacaactcacttcta |
38360211 |
T |
 |
| Q |
220 |
tctgctaattcatc |
233 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
38360212 |
tctgctaattcatc |
38360225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University