View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18021_high_44 (Length: 227)
Name: NF18021_high_44
Description: NF18021
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18021_high_44 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 12 - 210
Target Start/End: Original strand, 34406684 - 34406884
Alignment:
| Q |
12 |
cacagaggaagaatggtttgtagctttccatgagccattggaacatagccatttgatagaatgagg--gtgtagtttgcaaagtgctacaagatgtggtg |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
34406684 |
cacagaggaagaatggtttgtagctttccatgagccattggaacatagccatttgatagaatgagggagtgtagtttgcaaagtgctacaagatgtggtg |
34406783 |
T |
 |
| Q |
110 |
cagctatgttaagatttaaccttatcatactgtannnnnnnaggggnnnnnnnccttatcatgttgcatggttccatgcaaaagtgtgaccacctgtaga |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34406784 |
cagctatgttaagatttaaccttatcatactgtatttttttaggggaaaaaaaccttatcatgttgcatggttccatgcaaaagtgtgaccacctgtaga |
34406883 |
T |
 |
| Q |
210 |
g |
210 |
Q |
| |
|
| |
|
|
| T |
34406884 |
g |
34406884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University