View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18021_low_32 (Length: 330)
Name: NF18021_low_32
Description: NF18021
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18021_low_32 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 274; Significance: 1e-153; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 274; E-Value: 1e-153
Query Start/End: Original strand, 19 - 320
Target Start/End: Original strand, 47538220 - 47538521
Alignment:
| Q |
19 |
ctatcagtggcaaacatcaatcttaagataaagattctttgttaagaaggatctaatgttcacatgcttctagttgtacacaacatatgaaatttgccaa |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47538220 |
ctatcagtggcaaacatcaatcttaagataaagattctttgttaaaaaggatctaatgttcacatgcttctagttgtacacaacatatgaaatttgccaa |
47538319 |
T |
|
| Q |
119 |
attaaactaaatgattcacacatgacacacctagtttattctgaaacttttcccaatatatcaacattatttattatttgtaccggaaaaacaactagtg |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47538320 |
attaaactaaatgattcacacatgacacacctagtttattctgaaactgttcccaatatatcaacattatttattatttgtaccggaaaaacaactagtg |
47538419 |
T |
|
| Q |
219 |
ggttgcatctttaatgatggtgagtgaatagtgataaagaccaaatatttcattcagtgtgcatgtcttttagagcccaatgctcacggcattgcacctt |
318 |
Q |
| |
|
||||||||||||||||||| || |||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||| || |
|
|
| T |
47538420 |
ggttgcatctttaatgatgatgggtgaatagtgataaagaccaaatatttcgttcagtgtgcatgtcttttagagcccactgctcacggcattgcacttt |
47538519 |
T |
|
| Q |
319 |
tg |
320 |
Q |
| |
|
|| |
|
|
| T |
47538520 |
tg |
47538521 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 250 - 320
Target Start/End: Original strand, 47545734 - 47545804
Alignment:
| Q |
250 |
tgataaagaccaaatatttcattcagtgtgcatgtcttttagagcccaatgctcacggcattgcacctttg |
320 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||| || | ||||||| |||||||| |||| |
|
|
| T |
47545734 |
tgataaagaccaaaaatttcattcagtgtgcatgtcttttagtgcttactgctcacaacattgcacttttg |
47545804 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University