View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18021_low_36 (Length: 250)
Name: NF18021_low_36
Description: NF18021
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18021_low_36 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 9 - 250
Target Start/End: Original strand, 40056805 - 40057047
Alignment:
| Q |
9 |
gaagaatataatgtaggaaaagaatagttctcattagaatgaattgcatctctttataagtcttaagattcacttgcctctcaattggagattaaacatt |
108 |
Q |
| |
|
|||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40056805 |
gaagaaaataatgtagtaaaagaatagttctcattagaatgaattgcatctctttataagtcttaagattcacttgcctctcaattggagattaaacatt |
40056904 |
T |
 |
| Q |
109 |
gt-atgagaagataacagaataactaccgcactaacttcctagttatcttctgtcaaaagaaaaaataatttccaatcacctaacacatagtgcataatc |
207 |
Q |
| |
|
|| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
40056905 |
gttataagaagataacagaataactaccgcactaacttcctagttatcttctgtcaaaagaaaaaataatttccaattacctaacacatagtgcataata |
40057004 |
T |
 |
| Q |
208 |
tgaatccagaaactagtaactctgccattgcttccatcatcca |
250 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
40057005 |
tgaatccacaaactagtaactctgccattgcttccatcatcca |
40057047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University