View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18021_low_43 (Length: 234)
Name: NF18021_low_43
Description: NF18021
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18021_low_43 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 1 - 220
Target Start/End: Original strand, 18940803 - 18941032
Alignment:
| Q |
1 |
ttcaagacggttaggtaggatgatttcaattctaggtcagaaatggaagatattttaattacaaatttatgatttaaaagaaacacaaatttaaa----- |
95 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18940803 |
ttcaagacggttaggtaggatgatttcaattctaggtcagaaatggaagatattttaattacaaatttatgatttaaaagaaacacaaatttaaaattca |
18940902 |
T |
 |
| Q |
96 |
-----aggaaacctaattggaagggtgattgtaagaataatacctctttgcagattcctgatcttcttcagcggcgataaaaaggaaccttttccgtcga |
190 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
18940903 |
ataaaaggaaacctaattggaagggtgattgtaagaataatacctctttgcagattcctgatcttcttcagcggcgataaaaagaaaccttttccgtcga |
18941002 |
T |
 |
| Q |
191 |
tcaaaactgaatagattttagcgacctttg |
220 |
Q |
| |
|
|||||||| ||||||||||||||||||||| |
|
|
| T |
18941003 |
tcaaaactaaatagattttagcgacctttg |
18941032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University