View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18022_high_4 (Length: 429)
Name: NF18022_high_4
Description: NF18022
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18022_high_4 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 243; Significance: 1e-134; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 243; E-Value: 1e-134
Query Start/End: Original strand, 8 - 299
Target Start/End: Complemental strand, 5896605 - 5896318
Alignment:
| Q |
8 |
catcatcacaaggggctgctgaagctgtgaagaatgcaactggaattaacaaaaagtgatccaattaagcagaagggatcctagtaattaatccagtttt |
107 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||| |
|
|
| T |
5896605 |
catcagcacaaggggctgctgaagctgtgaagaatgcaactggaattaacaaaaagtgatccaattaagcagaagggatcctagtcat----ccagtttt |
5896510 |
T |
|
| Q |
108 |
actcggttttattttcttcttctagggcattatgtataaaaaagtgctctaatttgtgtttgtaattttgttttgctcccaattagatatcttgtgaata |
207 |
Q |
| |
|
|||| ||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5896509 |
actcagttttttttctttcttctagggcattatgtataaaaaagtgctctaatttgtgtttgtaattttgttttgctcccaattagatatcttgtgaata |
5896410 |
T |
|
| Q |
208 |
actctttgtttcaacgagagaactaggatgtagttctcggttaattcattaatcaatgaaatttatattagaataatcaactacttttttat |
299 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
5896409 |
actctttgtttcaacaagagaactaggatgtagttctcggttaattcattaatcaatgaaatttatattagaataatcaactactcttttat |
5896318 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 298 - 329
Target Start/End: Complemental strand, 5896284 - 5896253
Alignment:
| Q |
298 |
atattggaactaaatcaaatatgtgcttattt |
329 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
5896284 |
atattggaactaaatcaaatatgtgcttattt |
5896253 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 344 - 414
Target Start/End: Complemental strand, 5896249 - 5896179
Alignment:
| Q |
344 |
gggcggttttgccacccaactagcctggctacacgcccgggttcgacccatacttagcagcggatctcttt |
414 |
Q |
| |
|
|||||||||| ||||||||||||| ||| |||| || ||||| ||||||||| ||| |||||||||||| |
|
|
| T |
5896249 |
gggcggttttaccacccaactagcttgggcacacacctaggttcaacccatactcagcggcggatctcttt |
5896179 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 341 - 415
Target Start/End: Original strand, 33999902 - 33999976
Alignment:
| Q |
341 |
caggggcggttttgccacccaactagcctggctacacgcccgggttcgacccatacttagcagcggatctctttg |
415 |
Q |
| |
|
||||||||| ||| ||||||||||||||||| || |||||||| || |||||| || || ||||||||||||| |
|
|
| T |
33999902 |
caggggcggatttaccacccaactagcctgggcacgcgcccgggctcaacccatgctcaggggcggatctctttg |
33999976 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 341 - 414
Target Start/End: Original strand, 6042067 - 6042140
Alignment:
| Q |
341 |
caggggcggttttgccacccaactagcctggctacacgcccgggttcgacccatacttagcagcggatctcttt |
414 |
Q |
| |
|
||||||||| ||| ||||||| ||||||||| || |||||||| || ||||||||| || |||||||||||| |
|
|
| T |
6042067 |
caggggcggatttaccacccagctagcctgggcacgcgcccgggctctacccatactcaggggcggatctcttt |
6042140 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 342 - 398
Target Start/End: Complemental strand, 22486506 - 22486450
Alignment:
| Q |
342 |
aggggcggttttgccacccaactagcctggctacacgcccgggttcgacccatactt |
398 |
Q |
| |
|
|||||| | ||| ||||||||||||||||| || |||||||| ||||||||||||| |
|
|
| T |
22486506 |
aggggcagatttaccacccaactagcctgggcacgcgcccgggctcgacccatactt |
22486450 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University