View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18022_low_7 (Length: 269)
Name: NF18022_low_7
Description: NF18022
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18022_low_7 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 141; Significance: 5e-74; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 141; E-Value: 5e-74
Query Start/End: Original strand, 17 - 265
Target Start/End: Complemental strand, 473733 - 473480
Alignment:
| Q |
17 |
agttctcaatgtgagatttgtttaagaaatgcgattggaacattggcacagtgttgcagtggacgagagggtgcaagtgctttgcttgcatcttgtattg |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
473733 |
agttctcaatgtgagatttgtttaagaaatgcgattggaacattgccaaagtgttgcagtggacgagagggtgcaagtgctttgcttgcttcttgtattg |
473634 |
T |
 |
| Q |
117 |
ttagatatcaactctaccctttttacaacttatatggttcatcaccatcatcatcttcttct----tcttcaggtacttatattaaatgtttaattaata |
212 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| || | || || || | || | |||| |||||||||||||||||||||| |
|
|
| T |
473633 |
ttagatatcaactctacccgttttacaacttatatggttcttcttcttcttcttcaggtactttaatattcattgcattatattaaatgtttaattaatt |
473534 |
T |
 |
| Q |
213 |
aat-tacatgatcaaagattaggcactatggaactgtttaattcatcacctttg |
265 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
473533 |
aatatacatgatcaaagattaggcactatggaactgtttaattcatcacttttg |
473480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 84 - 140
Target Start/End: Complemental strand, 456429 - 456373
Alignment:
| Q |
84 |
agggtgcaagtgctttgcttgcatcttgtattgttagatatcaactctacccttttt |
140 |
Q |
| |
|
|||||||||| ||||||||| | ||||||| |||||||||||||||||||||||||| |
|
|
| T |
456429 |
agggtgcaagagctttgcttccttcttgtaatgttagatatcaactctacccttttt |
456373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University