View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18023_high_11 (Length: 276)
Name: NF18023_high_11
Description: NF18023
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18023_high_11 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 94; Significance: 6e-46; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 94; E-Value: 6e-46
Query Start/End: Original strand, 88 - 185
Target Start/End: Complemental strand, 51728672 - 51728575
Alignment:
| Q |
88 |
ttaccttcgtattgaacaactctagctggaataccgaatgaattaatattttcactatcttcccatcttactttaatcttaatccgataccatctata |
185 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
51728672 |
ttaccttcgtattgaacaactctagctggaataccgaatgaattaatattttcactatcttcccatcgtactttaatcttaatccgataccatctata |
51728575 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 5 - 37
Target Start/End: Complemental strand, 51728751 - 51728719
Alignment:
| Q |
5 |
aaggtacaggatataagggagtttgattgcttc |
37 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
51728751 |
aaggtacaggatataagggagtttgattgcttc |
51728719 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University