View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18023_high_5 (Length: 440)
Name: NF18023_high_5
Description: NF18023
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18023_high_5 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 216; Significance: 1e-118; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 216; E-Value: 1e-118
Query Start/End: Original strand, 18 - 250
Target Start/End: Original strand, 26519276 - 26519510
Alignment:
| Q |
18 |
accttgatcttggaaactatgaacgtttcttggacatcaaattgacccgcgacaataacatcactactggaaaaatttatcaggtgaacaaatgaacgtc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26519276 |
accttgatcttggaaactatgaacgtttcttggacatcaaattgacccgcgacaataacatcactactggaaaaatttatcaggtgaacaaatgaacgtc |
26519375 |
T |
|
| Q |
118 |
cttt--acctatatttattatttggttttgacttgccatgcctaacgtgttgttggacttttatttgaatgtcttttagtttgttattgagaaggagaga |
215 |
Q |
| |
|
|||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
26519376 |
ctttttacctgtatttattatttggttttgacttgccatgcctaacgtgttgttggacttttatttgaatgtcttttagtctgttattgagaaggagaga |
26519475 |
T |
|
| Q |
216 |
agaggagattatcttggaaagactgttcaggtatg |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
26519476 |
agaggagattatcttggaaagactgttcaggtatg |
26519510 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 91; E-Value: 6e-44
Query Start/End: Original strand, 335 - 425
Target Start/End: Original strand, 26519595 - 26519685
Alignment:
| Q |
335 |
taggttgttccacacataacagatgccatccaagagtggatagagcgtgtagcacagattccggttgatggtaaagaagggcctgccgatg |
425 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26519595 |
taggttgttccacacataacagatgccatccaagagtggatagagcgtgtagcacagattccggttgatggtaaagaagggcctgccgatg |
26519685 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 74; Significance: 9e-34; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 74; E-Value: 9e-34
Query Start/End: Original strand, 18 - 103
Target Start/End: Original strand, 18357844 - 18357929
Alignment:
| Q |
18 |
accttgatcttggaaactatgaacgtttcttggacatcaaattgacccgcgacaataacatcactactggaaaaatttatcaggtg |
103 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||| ||||||||||||||||||||| |
|
|
| T |
18357844 |
accttgatcttggaaactatgaacgtttcttggacatcaaattaacccgcgacaataatatcacaactggaaaaatttatcaggtg |
18357929 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 335 - 425
Target Start/End: Original strand, 18358183 - 18358273
Alignment:
| Q |
335 |
taggttgttccacacataacagatgccatccaagagtggatagagcgtgtagcacagattccggttgatggtaaagaagggcctgccgatg |
425 |
Q |
| |
|
||||||||||||||||| |||||||| ||||||||||||||||| ||||||||||| | ||||||||||| |||||||| ||||| |||| |
|
|
| T |
18358183 |
taggttgttccacacatcacagatgctatccaagagtggatagaacgtgtagcacaagtaccggttgatggaaaagaaggccctgctgatg |
18358273 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 192 - 250
Target Start/End: Original strand, 18358036 - 18358094
Alignment:
| Q |
192 |
tagtttgttattgagaaggagagaagaggagattatcttggaaagactgttcaggtatg |
250 |
Q |
| |
|
|||| |||| |||||||||| |||||||||||||||||||| || ||||| |||||||| |
|
|
| T |
18358036 |
tagtctgttgttgagaaggaaagaagaggagattatcttggcaaaactgtccaggtatg |
18358094 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University