View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18025_high_25 (Length: 327)

Name: NF18025_high_25
Description: NF18025
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18025_high_25
NF18025_high_25
[»] chr3 (1 HSPs)
chr3 (19-163)||(33673170-33673312)


Alignment Details
Target: chr3 (Bit Score: 102; Significance: 1e-50; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 19 - 163
Target Start/End: Complemental strand, 33673312 - 33673170
Alignment:
19 agttgttgtccattaggtgaactcattatcgaaccttgacttagctagctagcttatcaagacaatggttcccttctttatatatgtgtgataatgcaag 118  Q
    |||| |||||||| | ||||||| |||| || ||||||||||||||||||||||||||||||||||| ||||||||||||||||  ||||||||||||||    
33673312 agttattgtccatcaagtgaacttattaacggaccttgacttagctagctagcttatcaagacaatgattcccttctttatata--tgtgataatgcaag 33673215  T
119 tcatatagctcatcatgtgaatgtagttaagccataaattcttca 163  Q
    |||||||||||||||||||||||||||||||||||| ||||||||    
33673214 tcatatagctcatcatgtgaatgtagttaagccatatattcttca 33673170  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University