View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18025_high_28 (Length: 292)
Name: NF18025_high_28
Description: NF18025
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18025_high_28 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 18 - 274
Target Start/End: Original strand, 49395030 - 49395286
Alignment:
| Q |
18 |
atcaacaaaccctgcacacgtaacaaatttatgaataatgctaaaaacatttatattaacatttctttttaaaactcattaatttatgggatgaaataca |
117 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
49395030 |
atcaacaaaccctctacacgtaacaaatttatgaacaatgctaaaaacatttatattaacatttttttttaaaactcattaatttatgggatgaaataca |
49395129 |
T |
 |
| Q |
118 |
tatgatgtgacccacttgtattttattcaataaaaaataaaatttattcgtaattgactatgtgctaagtatactcttgctcaatcttattatattatat |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49395130 |
tatgatgtgacccacttgtattttattcaataaaaaataaaatttattcgtaattgactctgtgctaagtatactcttgctcaatcttattatattatat |
49395229 |
T |
 |
| Q |
218 |
gtctgggttaaaatatttatcaatctcaaattatttatcattttatgatatcaatat |
274 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49395230 |
gtctgggttaaaatatttatcaatctcaaattatttatcattttatgatatcaatat |
49395286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 241 - 274
Target Start/End: Complemental strand, 10917674 - 10917641
Alignment:
| Q |
241 |
tctcaaattatttatcattttatgatatcaatat |
274 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| |
|
|
| T |
10917674 |
tctcaaattatttatcattttataatatcaatat |
10917641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University