View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18025_high_33 (Length: 269)
Name: NF18025_high_33
Description: NF18025
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18025_high_33 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 227; Significance: 1e-125; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 20 - 262
Target Start/End: Complemental strand, 36650489 - 36650247
Alignment:
| Q |
20 |
ttctgcacgaatggaaaggattcaggggtgttccctttttccttactatgatgggtaatctaaaaaatgtagctgtcgccttggcaggtgagatacgaga |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36650489 |
ttctgcacgaatggaaaggattcaggggtgttccctttttccttactatgatgggtaatctaaaaaatgtagctgtcgccttggcaggtgagatacgaga |
36650390 |
T |
|
| Q |
120 |
tggggtgtacagccatttgaggccgcagctgttacacgccctaccgttctctaggtgtcactatgcaacttggggcaccataagaggatacaataatcca |
219 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||| ||||||||||| |
|
|
| T |
36650389 |
tggggtgtacagccgtttgaggccgcagctgttacacgccctaccgttctctaggtgtcactatgcaacttggggcatcataataggacacaataatcca |
36650290 |
T |
|
| Q |
220 |
gagttcgagtttcctaaacaagagaaagtgaaagcctttgctt |
262 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36650289 |
gagttcgagtttcctaaacaagagaaagtgaaagcctttgctt |
36650247 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 109; E-Value: 7e-55
Query Start/End: Original strand, 20 - 224
Target Start/End: Original strand, 36643081 - 36643285
Alignment:
| Q |
20 |
ttctgcacgaatggaaaggattcaggggtgttccctttttccttactatgatgggtaatctaaaaaatgtagctgtcgccttggcaggtgagatacgaga |
119 |
Q |
| |
|
|||||||| |||||||||||||| ||||||| |||||||||||| |||||||||||||||| | |||||| | ||| ||||||||||||||||||||||| |
|
|
| T |
36643081 |
ttctgcacaaatggaaaggattccggggtgtaccctttttccttgctatgatgggtaatctgagaaatgttgatgttgccttggcaggtgagatacgaga |
36643180 |
T |
|
| Q |
120 |
tggggtgtacagccatttgaggccgcagctgttacacgccctaccgttctctaggtgtcactatgcaacttggggcaccataagaggatacaataatcca |
219 |
Q |
| |
|
||||| | ||||| ||||||||| |||||||||||| |||||||||||||||||||| | || ||| |||||||| |||||||||| |||| | |||| |
|
|
| T |
36643181 |
aggggtatgcagccgtttgaggcctcagctgttacacatcctaccgttctctaggtgtcgcaatacaatttggggcatcataagaggacacaagattcca |
36643280 |
T |
|
| Q |
220 |
gagtt |
224 |
Q |
| |
|
||||| |
|
|
| T |
36643281 |
gagtt |
36643285 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University