View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18025_high_38 (Length: 244)
Name: NF18025_high_38
Description: NF18025
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18025_high_38 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 163; Significance: 4e-87; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 163; E-Value: 4e-87
Query Start/End: Original strand, 21 - 198
Target Start/End: Original strand, 19350511 - 19350689
Alignment:
| Q |
21 |
atcacttgatatggttggtaatccatattccatattccatacaaaataagctaaacacttgttcagtcattctgttttcacttttcatcacacacctcac |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
19350511 |
atcacttgatatggttggtaatccatattccatattccatacaaaataagctaaacacttgttcagtgattctgttttcacttttcatcacacacctcac |
19350610 |
T |
 |
| Q |
121 |
aaaacatagcaatta-ccacacacacaactttggataaaagataattaattactttaaactatagaactcttgtcaaat |
198 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
19350611 |
aaaacatagcaattacccacacacacaactttggataaaagataattaattactttaaactatagaacttttgtcaaat |
19350689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University