View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18025_high_46 (Length: 213)
Name: NF18025_high_46
Description: NF18025
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18025_high_46 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 19 - 203
Target Start/End: Complemental strand, 30980379 - 30980195
Alignment:
| Q |
19 |
catccacttcccaaaaaccatcattgtaattttctctctttattattttcttctcctcatgattgcatttgcttatgttctcatctttcccttcatcaaa |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30980379 |
catccacttcccaaaaaccatcattgtaattttctctctttattattttcttctcctcataattgcatttgcttatgttctcatctttcccttcatcaaa |
30980280 |
T |
 |
| Q |
119 |
ggaaaatccttcccattccatgatatcccaatgaagctcattactactattacaagtgttttgtggtgatgatacctttgcttct |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
30980279 |
ggaaaatccttcccattccatgatatcccaatgaagctcattactactattacaagtgttttgtggtgatgataccttttcttct |
30980195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University