View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18025_high_48 (Length: 203)
Name: NF18025_high_48
Description: NF18025
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18025_high_48 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 30 - 200
Target Start/End: Complemental strand, 30980177 - 30980007
Alignment:
| Q |
30 |
gacgatgttcaagtactcttcgagttcgtcgaaaagatagaaatcttcattagtgtaagatttgttgaagtttgatggtatttgagtggtagcttctggt |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30980177 |
gacgatgttcaagtactcttcgagttcgtcgaaaagatagaaatcttcattagtgtaagatttgttgaagtttgatggtatttgagtggtagcttctggt |
30980078 |
T |
|
| Q |
130 |
acttcatgttcttctttctttggacttctaagagatgaagtgtatctcatcttatctttacaaagtagctt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30980077 |
acttcatgttcttctttctttggacttctaagagatgaagtgtatctcatcttatctttacaaagtagctt |
30980007 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University