View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18025_low_33 (Length: 282)
Name: NF18025_low_33
Description: NF18025
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18025_low_33 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 1 - 272
Target Start/End: Original strand, 39384863 - 39385134
Alignment:
| Q |
1 |
ttagagttttgtttttattttcaagcttggnnnnnnnnagctagtttatgacccaatgaaattatttaggtttaaatgtgattttagtacatgcatgatg |
100 |
Q |
| |
|
|||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39384863 |
ttagggttttgtttttattttcaagcttggttttttttagctagtttatgacccaatgaaattatttaggtttaaatgtgattttagtacatgcatgatg |
39384962 |
T |
|
| Q |
101 |
catatatacattttttgctttcagttcatgtagaatattttctttgtttttattagctctgtaacaccaacatctctgatggaaactgtgtttggtgtcc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
39384963 |
catatatacattttttgctttcagttcatgtagaatattttctttgtttttattagctctgtaacaccaacatttctcatggaaactgtgtttggtgtct |
39385062 |
T |
|
| Q |
201 |
gacattgacacatgtcattacgttcaattgattcattttaggtcagtgtcgtgtccggtgtcggtgtctgtg |
272 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39385063 |
gacattgacacatgtcattacggtcaattgattcattttaggtcagtgtcgtgtccggtgtcggtgtctgtg |
39385134 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University