View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18025_low_37 (Length: 256)
Name: NF18025_low_37
Description: NF18025
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18025_low_37 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 11 - 240
Target Start/End: Original strand, 17267216 - 17267439
Alignment:
| Q |
11 |
catagggacacatgaattttcactataacatccaaaaataacaaccatagtcactcaagttcataatttactcatgaatttctcaatttcacaaaaatat |
110 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| || |
|
|
| T |
17267216 |
catagagacacatgaattttcactataacatccaaaaataacaaccatagtcactcaagttcttaatttactcatgaatttctcaatttcacaaaaacat |
17267315 |
T |
|
| Q |
111 |
tcatcattttaatcacttacaacatcgcatgacaacattttctaaaatcatatccctaacatgtgaatcccttatccaacatcaagaggtttcaaaaatc |
210 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17267316 |
tcatcattttaatcactt------tcgcatgacaacattttctaaaatcatatccctaacatgtgaatcccttatccaacatcaagaggtttcaaaaatc |
17267409 |
T |
|
| Q |
211 |
aacattggatttttaatttgaagaacaaaa |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
17267410 |
aacattggatttttaatttgaagaacaaaa |
17267439 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University