View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18025_low_43 (Length: 238)
Name: NF18025_low_43
Description: NF18025
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18025_low_43 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 128; Significance: 3e-66; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 362982 - 362763
Alignment:
| Q |
1 |
atataataatgcattgtctacaaatatacattatttaactattccacggaagaaccaattgttcgaatgaaatcgagtttatcttctagattgaacaann |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| || |||||| ||||||||| |
|
|
| T |
362982 |
atataataatgcattgtctacaaatatacattatttaactactccacggaagaaccaattgttcgaatgaaatcgag-ttgccttctaaattgaacaatt |
362884 |
T |
 |
| Q |
101 |
nnnnngcaagactttatttacatccggactaaactttaaattataatgggatcattctcctaaaaaccgaagggttnnnnnnnnnnntacattccttgac |
200 |
Q |
| |
|
||||||||||| |||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
362883 |
tttttgcaagactttacttacatcccgaccaaactttaaattataatgggatcattctcctaaaaaccgaagggtt--aaaaaaaaatacattccttgac |
362786 |
T |
 |
| Q |
201 |
tactactcaacttctgtaaatat |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
362785 |
tactactcaacttctgtaaatat |
362763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University