View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18025_low_44 (Length: 237)
Name: NF18025_low_44
Description: NF18025
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18025_low_44 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 11 - 237
Target Start/End: Complemental strand, 39600841 - 39600615
Alignment:
| Q |
11 |
caaagggcaatgtattggcacattgaagctcgtgttgttttggatcttcaagaattactcaattctgtaagcacattcttaaacatttgctgttgttttt |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39600841 |
caaagggcaatgtattggcacattgaagctcgtgttgttttggatcttcaagaattactcaattctgtaagcacattcttaaacatttgctgttgttttt |
39600742 |
T |
 |
| Q |
111 |
tcttcaatgattttgttactgcatactagaaaaatagcaattagttctatgtgtgactgtgaagtggataacattgagaagagtggatagaatttatgac |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39600741 |
tcttcaatgattttgttactgcatactagaaaaatagcaattagttctatgtgtgactgtgaagtggataacattgagaagagtggatagaatttatgac |
39600642 |
T |
 |
| Q |
211 |
gtagagcacagagagtataaaaataaa |
237 |
Q |
| |
|
||| ||||||||||||||||||||||| |
|
|
| T |
39600641 |
gtatagcacagagagtataaaaataaa |
39600615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University