View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18025_low_46 (Length: 229)

Name: NF18025_low_46
Description: NF18025
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18025_low_46
NF18025_low_46
[»] chr5 (1 HSPs)
chr5 (18-178)||(12295307-12295467)


Alignment Details
Target: chr5 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 18 - 178
Target Start/End: Complemental strand, 12295467 - 12295307
Alignment:
18 gtattttagtagtttcgatgatttaataaagccagttgggttttagttggaggagtaagtgtaaagattctgtttctggaaacttttgtaattgaccaaa 117  Q
    |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
12295467 gtattttagtagtttcaatgatttaataaagccagttgggttttagttggaggagtaagtgtaaagattctgtttctggaaacttttgtaattgaccaaa 12295368  T
118 ataccatatgaatagtgtgaaatcacttaaatacctatagtccgttttatgttgtgacttt 178  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
12295367 ataccatatgaatagtgtgaaatcacttaaatacctatagtccgttttatgttgtgacttt 12295307  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University