View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18026_low_7 (Length: 254)
Name: NF18026_low_7
Description: NF18026
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18026_low_7 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 164; Significance: 9e-88; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 164; E-Value: 9e-88
Query Start/End: Original strand, 18 - 251
Target Start/End: Original strand, 4536623 - 4536874
Alignment:
| Q |
18 |
ggtggtcatcgtggcggtttgaaaaagtaaacagtaggtggtggtggt---agttgtggcggtcgtatgtaagtgtaaattggcgggaggttaatgattg |
114 |
Q |
| |
|
||||||| |||||| |||| ||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4536623 |
ggtggtcgtcgtggtggttcgaaaaagtaaacaataggtggtggtggtggtagttgtggcggtcgtatgtaagtgtaaattggcgggaggttaatgattg |
4536722 |
T |
|
| Q |
115 |
gag---------------gcttgtaatttgggaaggtgtaaattggaggtttatatataggtactaataaatcagcaagcccttgagaaacaaggataag |
199 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4536723 |
gaggcttgttaatcggaggcttgtaatttgggaaggtgtaaattggaggtttatatataggtactaataaatcagcaagcccttgagaaacaaggataag |
4536822 |
T |
|
| Q |
200 |
agcagcaaggaacaacaatagtaaggataggtaaaatgaagccatattaaga |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
4536823 |
ggcagcaaggaacaacaatagtaaggataggtaaaatgaagccattttaaga |
4536874 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 172 - 212
Target Start/End: Original strand, 4539625 - 4539665
Alignment:
| Q |
172 |
cagcaagcccttgagaaacaaggataagagcagcaaggaac |
212 |
Q |
| |
|
||||||||||||||| || ||||||||||||||||| |||| |
|
|
| T |
4539625 |
cagcaagcccttgaggaagaaggataagagcagcaatgaac |
4539665 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 172 - 212
Target Start/End: Original strand, 4556259 - 4556299
Alignment:
| Q |
172 |
cagcaagcccttgagaaacaaggataagagcagcaaggaac |
212 |
Q |
| |
|
||||||||||||||| || ||||||||||||||||| |||| |
|
|
| T |
4556259 |
cagcaagcccttgaggaagaaggataagagcagcaatgaac |
4556299 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University