View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18026_low_8 (Length: 223)
Name: NF18026_low_8
Description: NF18026
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18026_low_8 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 136; Significance: 4e-71; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 70 - 209
Target Start/End: Original strand, 32611868 - 32612007
Alignment:
| Q |
70 |
acattcttggtcatttatttctgatattggtttatgagtacttattgttccatggagaatcatatttggctgctggaggtgaacaaatcttcaagattct |
169 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
32611868 |
acattcttggtcatttatttctgatattggtttatgagtacttattgttccatggagaatcatatttggctgctggaggtgaacaaatattcaagattct |
32611967 |
T |
 |
| Q |
170 |
tggtccaggtgtttttggtgctagtgcttttgatattctt |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32611968 |
tggtccaggtgtttttggtgctagtgcttttgatattctt |
32612007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 70 - 209
Target Start/End: Original strand, 32630074 - 32630213
Alignment:
| Q |
70 |
acattcttggtcatttatttctgatattggtttatgagtacttattgttccatggagaatcatatttggctgctggaggtgaacaaatcttcaagattct |
169 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
32630074 |
acattcttggtcatttatttctgatattggtttatgagtacttattgttccatggagaatcatatttggctgctggaggtgaacaaatattcaagattct |
32630173 |
T |
 |
| Q |
170 |
tggtccaggtgtttttggtgctagtgcttttgatattctt |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32630174 |
tggtccaggtgtttttggtgctagtgcttttgatattctt |
32630213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University