View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18027_low_9 (Length: 233)
Name: NF18027_low_9
Description: NF18027
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18027_low_9 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 220; Significance: 1e-121; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 22016592 - 22016815
Alignment:
| Q |
1 |
aagtgctgctttgtgatgacttagcatagtgaatttgaaattatctcttactatgcaattcctgatcgatttttgtgttctacgctatttaccgaagcct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22016592 |
aagtgctgctttgtgatgacttagcatagtgaatttgaaattatctcttactatgcaattcctgatcgatttttgtgttctacgctatttaccgaagcct |
22016691 |
T |
 |
| Q |
101 |
cctcagatgaattgtctggatgaaattcaaccttattgtgaagagcaagcaaaagatgatctatccatggtagaaactgaacgtaatgaagggacagata |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
22016692 |
cctcagatgaattgtctggatgaaattcaaccttattgtgaagagcaagcaaaagatgatctatccatggtagaaactgaacgtaatgaagggaaagata |
22016791 |
T |
 |
| Q |
201 |
ataatgaaaataatgctgatgatg |
224 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
22016792 |
ataatgaaaataatgctgatgatg |
22016815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 188 - 222
Target Start/End: Original strand, 22016830 - 22016864
Alignment:
| Q |
188 |
gaagggacagataataatgaaaataatgctgatga |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
22016830 |
gaagggacagataataatgaaaataatgctgatga |
22016864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University