View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18028_low_17 (Length: 221)
Name: NF18028_low_17
Description: NF18028
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18028_low_17 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 95; Significance: 1e-46; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 1 - 115
Target Start/End: Complemental strand, 33272945 - 33272831
Alignment:
| Q |
1 |
gtcacatgtcttgtggacctataaactcactttgtaatattcttctctttcttcatccttatcctctcccttctctaccatatgcctcatgaagactaca |
100 |
Q |
| |
|
||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
33272945 |
gtcacatgtcttgtggacctagaaactcattttgtaatattcttctctttcttcatccttatcctctcccttctcaaccatatgcctcatgaagactaca |
33272846 |
T |
|
| Q |
101 |
atgagacttatctgt |
115 |
Q |
| |
|
||| |||||||||| |
|
|
| T |
33272845 |
ttgacacttatctgt |
33272831 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University