View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18028_low_19 (Length: 210)
Name: NF18028_low_19
Description: NF18028
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18028_low_19 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 210
Target Start/End: Complemental strand, 36870150 - 36869941
Alignment:
| Q |
1 |
ggtttgatttgacctataggatttttggtcttcttttacctctaacaattggaatattctacttactgtagtgtttttgtttatatatatgaccaaagag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36870150 |
ggtttgatttgacctataggatttttggtcttcttttacctctaacaattggaatattctacttactgtagtgtttttgtttatatatatgaccaaagag |
36870051 |
T |
 |
| Q |
101 |
attttatcttcttctctattgtagggacatccttaattttgtcccttacatatctaatcctatcttgtcttctggaacaactcactatcataatgttcta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
36870050 |
attttatcttcttctctattgtagggacatccctaattttgtcccttacatatctaatcctatcttgtcttctggaacaagtcactatcataatgttcta |
36869951 |
T |
 |
| Q |
201 |
tttatgtgtt |
210 |
Q |
| |
|
|||||||||| |
|
|
| T |
36869950 |
tttatgtgtt |
36869941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University