View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1802_high_22 (Length: 322)
Name: NF1802_high_22
Description: NF1802
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1802_high_22 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 99; Significance: 7e-49; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 99; E-Value: 7e-49
Query Start/End: Original strand, 157 - 310
Target Start/End: Complemental strand, 45815899 - 45815744
Alignment:
| Q |
157 |
cactcaagtgagacatttaagaaataaatcagtatacaaaatggcgaaactattattacaaattattcaagagtttaannnnnnnnnnnnnngac--aca |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||| |
|
|
| T |
45815899 |
cactcaagtgagacatttaagaaataaatcagtatacaaaatggcgaaactattattacaaattattcaagagtttaatttttcatttttttgacaaaca |
45815800 |
T |
 |
| Q |
255 |
gtttaaatttcatatatccctaaaaagaagtttaaatttcatattcttattgagta |
310 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
45815799 |
gtttaaatttcatatatccctaaaaaaaagtttaaatttcatattcttattgagta |
45815744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 1 - 58
Target Start/End: Complemental strand, 45816055 - 45815998
Alignment:
| Q |
1 |
atgaatcaaggtctcatcattcaattaaattattttctaaaatagaaactttctccaa |
58 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45816055 |
atgaatcaaggtctcatcattcaattaaattattttctaaaatagaaactttctccaa |
45815998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University