View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1802_high_28 (Length: 298)
Name: NF1802_high_28
Description: NF1802
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1802_high_28 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 271; Significance: 1e-151; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 271; E-Value: 1e-151
Query Start/End: Original strand, 17 - 287
Target Start/End: Original strand, 30805175 - 30805445
Alignment:
| Q |
17 |
cagggaccgctggggcggagacggcgaaaggggtgtttttagggctgttaggtaggtgtcatgttagtgctggtgccgcggtgagggtggcgagtagggt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30805175 |
cagggaccgctggggcggagacggcgaaaggggtgtttttagggctgttaggtaggtgtcatgttagtgctggtgccgcggtgagggtggcgagtagggt |
30805274 |
T |
|
| Q |
117 |
gctcggaggcagtggagaagggagtaaagtgagggctaaagtggttgctgagcttgtgtctgatgaaagggtagtggcgctttttgcagaaaaggatgct |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30805275 |
gctcggaggcagtggagaagggagtaaagtgagggctaaagtggttgctgagcttgtgtctgatgaaagggtagtggcgctttttgcagaaaaggatgct |
30805374 |
T |
|
| Q |
217 |
gctaaggatagaactgcaatgcatgctgttctgtggaattggtatgataatgttattacttttgggttcat |
287 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30805375 |
gctaaggatagaactgcaatgcatgctgttctgtggaattggtatgataatgttattacttttgggttcat |
30805445 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 218 - 287
Target Start/End: Original strand, 30806812 - 30806881
Alignment:
| Q |
218 |
ctaaggatagaactgcaatgcatgctgttctgtggaattggtatgataatgttattacttttgggttcat |
287 |
Q |
| |
|
||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||| || ||||||| |
|
|
| T |
30806812 |
ctaaggatagaacagcaatgcatgctgttctttggaattggtatgataatgttattactctttggttcat |
30806881 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University