View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1802_high_29 (Length: 298)
Name: NF1802_high_29
Description: NF1802
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1802_high_29 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 18 - 286
Target Start/End: Complemental strand, 34320913 - 34320651
Alignment:
| Q |
18 |
tggacttcgaagcatgttagctggatcagtggattatgtctgaggatcatccattcatgcaagagaagaggtggactatgtttcagcatctgttgatcaa |
117 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34320913 |
tggacttcgaagcatgctagctggatcagtggattatgtctgaggatcatccattcatgcaagagaagaggtggactatgtttcagcatctgttgatcaa |
34320814 |
T |
|
| Q |
118 |
tcaaaatctgagtactgttgattactgacatataagaggacatgatcgtgtgggtgtggatgttttatgtttctcttcaatgtaggcaattattttcaaa |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
34320813 |
tcaaaatctgagtactgttgattactgacatataagaggacatgatcgt------gtggatgttttatgtttctcttcaatgtaggcaatcattttcaaa |
34320720 |
T |
|
| Q |
218 |
ccattggaagcaactaaatctagaaacatctttccgtcaaaatttgaacattaattcatcatgtcgaga |
286 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
34320719 |
ccattggaagcaactaaatctagaaacatctttccgtcaaaattagaacattaattcatcatgtcgaga |
34320651 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University