View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1802_high_37 (Length: 242)
Name: NF1802_high_37
Description: NF1802
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1802_high_37 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 1 - 226
Target Start/End: Original strand, 45816097 - 45816330
Alignment:
| Q |
1 |
gattcgatcgaaaagtattcaataataactattgaggatctagtttggtcgacatnnnnnnnnnnnnca-------gtcatattcgctcagcaatcagta |
93 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||| |
|
|
| T |
45816097 |
gattcgatcgaaaagtagacaataataactattgaggatctagtttggtcgacataaaaaaaataaaaaataaaaagtcatattcgctcagcaatcagta |
45816196 |
T |
 |
| Q |
94 |
att-gctaactagttcttgacttcttgctgtccaagggggtcaatatagcaaaattatttagaactaaactggtaatatatcatttttctttctatctaa |
192 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45816197 |
atttgctaactagttcttgacttcttgctgtccaagggggtcaatatagcaaaattatttagaactaaactggtaatatatcatttttctttctatctaa |
45816296 |
T |
 |
| Q |
193 |
gatgataaaaatcttctaccaaaaatgcatattg |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
45816297 |
gatgataaaaatcttctaccaaaaatgcatattg |
45816330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University