View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1802_high_39 (Length: 239)
Name: NF1802_high_39
Description: NF1802
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1802_high_39 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 104; Significance: 6e-52; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 18 - 121
Target Start/End: Original strand, 4927162 - 4927265
Alignment:
| Q |
18 |
ctacaagctttcaagattccttcgttgaacacagcattgagctaattccttttgctgaacatggacgatatatagcgcttcaggattgatcagatcttgc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4927162 |
ctacaagctttcaagattccttcgttgaacacagcattgagctaattccttttgctgaacatggacgatatatagcgcttcaggattgatcagatcttgc |
4927261 |
T |
 |
| Q |
118 |
aggt |
121 |
Q |
| |
|
|||| |
|
|
| T |
4927262 |
aggt |
4927265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 22 - 87
Target Start/End: Complemental strand, 4904844 - 4904780
Alignment:
| Q |
22 |
aagctttcaagattccttcgttgaacacagcattgagctaattccttttgctgaacatggacgata |
87 |
Q |
| |
|
|||||| |||||||||||| || |||| || |||||||||||||| |||||||| ||||||||||| |
|
|
| T |
4904844 |
aagcttccaagattccttccttcaacaaagtattgagctaattcc-tttgctgatcatggacgata |
4904780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 193 - 222
Target Start/End: Original strand, 4921025 - 4921054
Alignment:
| Q |
193 |
gatcaaggataataaaatcttttaaataac |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
4921025 |
gatcaaggataataaaatcttttaaataac |
4921054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University