View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1802_low_13 (Length: 402)
Name: NF1802_low_13
Description: NF1802
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1802_low_13 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 350; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 350; E-Value: 0
Query Start/End: Original strand, 1 - 386
Target Start/End: Original strand, 28597967 - 28598352
Alignment:
| Q |
1 |
aaaatcctcaatatccatggtcacccaatttcctcttccagtcaataaatataacaacaaaatccctattgccttcacatctgatccaacattacattca |
100 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28597967 |
aaaatcctcaatatccatgggcacccaatttcctcttccagtcaataaatataacaacaaaacccctattgccttcacatctgatccaacattacattca |
28598066 |
T |
 |
| Q |
101 |
ttattgcactcatgaagaccaaacagtttaatctttgcaacaagattgttgtctaggaggatgttggatggagaaatatgacaatgagtaatgggcctgg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||| |
|
|
| T |
28598067 |
ttattgcactcatgaagaccaaacagtttgatctttgcaacaagattgttgtctaggaggatgttggatggagaaacatgacaatgagttatgggcctgg |
28598166 |
T |
 |
| Q |
201 |
gctgaaatgagtttataaagcccagcccggaacaaacttctatggctatccttatgcaatcttgccagcttatgaacttctttcttgtcttgcaaggtag |
300 |
Q |
| |
|
||||||||||| ||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28598167 |
gctgaaatgagcttagaaagcccagcccagaacaaacttctatggctatccttatgcaatcttgccagcttatgaacttctttcttgtcttgcaaggtag |
28598266 |
T |
 |
| Q |
301 |
gttttcttccaaactgccattgtgcatgtattccaatactaagcatttgggctcagagcagaatccaagtatagcaaccagatgag |
386 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
28598267 |
gttttcttccaaactgccattgtgcatgtattccaatactaagcatttgggctcagagcagaatccaagtataccaaccagatgag |
28598352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University