View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1802_low_16 (Length: 396)
Name: NF1802_low_16
Description: NF1802
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1802_low_16 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 132; Significance: 2e-68; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 132; E-Value: 2e-68
Query Start/End: Original strand, 20 - 170
Target Start/End: Original strand, 18006171 - 18006322
Alignment:
| Q |
20 |
aactcaaatctctgccttgaaacttgagttcaatattctgcttagatctttgaaaaaccaagtagtaaaaaattgaaactttaagtttattaatgacatc |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
18006171 |
aactcaaatctctgccttgaaacttgagttcaatattctgtttagatctttgaaaaaccaagtagtaaaatattgaaactttaagtttattaatgacatc |
18006270 |
T |
|
| Q |
120 |
-aatcccccaaatttagattatttatgattatcctttcacttctcattgatc |
170 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18006271 |
aaagcccccaaatttagattatttatgattatcctttcacttctcattgatc |
18006322 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 280 - 328
Target Start/End: Original strand, 18006424 - 18006472
Alignment:
| Q |
280 |
gaactggttcattcatactagaattggttaacagaaacagttttacctc |
328 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
18006424 |
gaactggttcattcatacaagaattggttaacagaaacagttttacctc |
18006472 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 353 - 382
Target Start/End: Original strand, 18006496 - 18006525
Alignment:
| Q |
353 |
caaccttttcaaatctgaagtcaagttagt |
382 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
18006496 |
caaccttttcaaatctgaagtcaagttagt |
18006525 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University