View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1802_low_22 (Length: 331)
Name: NF1802_low_22
Description: NF1802
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1802_low_22 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 304; Significance: 1e-171; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 304; E-Value: 1e-171
Query Start/End: Original strand, 11 - 314
Target Start/End: Complemental strand, 52296612 - 52296309
Alignment:
| Q |
11 |
cagagactaccaattccaagcaccataaatctggattgttttgccatagcacgaaacctcctacttcagctttgcctcttgaatgaacgctgttatcatc |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52296612 |
cagagactaccaattccaagcaccataaatctggattgttttgccatagcacgaaacctcctacttcagctttgcctcttgaatgaacgctgttatcatc |
52296513 |
T |
 |
| Q |
111 |
ggcaccatgacgcatctctgaaccatgtattctaacttctcccattgcatacatgttttgcaatgaattcaatgcaccttgtccaccggttgctgccaca |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52296512 |
ggcaccatgacgcatctctgaaccatgtattctaacttctcccattgcatacatgttttgcaatgaattcaatgcaccttgtccaccggttgctgccaca |
52296413 |
T |
 |
| Q |
211 |
tattgttgcactatgtatttcccaattgaatctctctgcccaaacatttcaatgaaaactatatatcattaactaattaattgaagtgcatcttgtagcg |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52296412 |
tattgttgcactatgtatttcccaattgaatctctctgcccaaacatttcaatgaaaactatatatcattaactaattaattgaagtgcatcttgtagcg |
52296313 |
T |
 |
| Q |
311 |
taat |
314 |
Q |
| |
|
|||| |
|
|
| T |
52296312 |
taat |
52296309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University