View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1802_low_36 (Length: 269)
Name: NF1802_low_36
Description: NF1802
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1802_low_36 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 169; Significance: 1e-90; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 50 - 222
Target Start/End: Complemental strand, 10677648 - 10677476
Alignment:
| Q |
50 |
cggtttctgataaaccgcggctggtaatacagttttttggctgccgaaaaacaaaaggaaaggtggtaattaccatgtttataatcacgcttgcattcga |
149 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10677648 |
cggtttctgataaaccgcggctggtaatacagttttttggctgcagaaaaacaaaaggaaaggtggtaattaccatgtttataatcacgcttgcattcga |
10677549 |
T |
|
| Q |
150 |
aacctttgatgtggtcccttctctccttagagttggtcactaatgattgtcggatataccatgttttatgata |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10677548 |
aacctttgatgtggtcccttctctccttagagttggtcactaatgattgtcggatataccatgttttatgata |
10677476 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 148 - 191
Target Start/End: Complemental strand, 10677407 - 10677364
Alignment:
| Q |
148 |
gaaacctttgatgtggtcccttctctccttagagttggtcacta |
191 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| |||||||||| |
|
|
| T |
10677407 |
gaaacctttgatgtggtcccttatctccttagatttggtcacta |
10677364 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University