View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1802_low_44 (Length: 239)
Name: NF1802_low_44
Description: NF1802
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1802_low_44 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 56 - 202
Target Start/End: Complemental strand, 17495088 - 17494942
Alignment:
| Q |
56 |
gtataaggtttgatgtccataattttcttgtcttttattttagcttcaccattcagacaaattcgaaggggtgccatatgggctgtttttgggaccaaag |
155 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17495088 |
gtataaggtttgatgtccataattttcttgtcttttattttagcttcaccattcagacaaattcgaaggggtgccatatgggctgtttttgggaccaaag |
17494989 |
T |
 |
| Q |
156 |
gtaagagttgtattcttgtatcttttttcttgtcctttgtatctttc |
202 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17494988 |
gtaagagctgtattcttgtatcttttttcttgtcctttgtatctttc |
17494942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 97 - 157
Target Start/End: Original strand, 45087944 - 45088004
Alignment:
| Q |
97 |
agcttcaccattcagacaaattcgaaggggtgccatatgggctgtttttgggaccaaaggt |
157 |
Q |
| |
|
|||| |||||||| |||||||| |||||||||||||||| || ||||| ||||||||||| |
|
|
| T |
45087944 |
agctccaccattcggacaaatttaaaggggtgccatatggactctttttaggaccaaaggt |
45088004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University