View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1802_low_47 (Length: 234)
Name: NF1802_low_47
Description: NF1802
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1802_low_47 |
 |  |
|
| [»] chr5 (2 HSPs) |
 |  |
|
| [»] scaffold0019 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 216; Significance: 1e-119; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 15 - 234
Target Start/End: Complemental strand, 2758756 - 2758537
Alignment:
| Q |
15 |
gtcttgatgtgctgagatggcatttccagaatgtttcaaatgatgttaaagacagtttaagtttggaattagttaagtggcttgagagacaagttaactg |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2758756 |
gtcttgatgtgctgagatggcatttccagaatgtttcaaatgatgttaaagacagtttaagtttggaattagttaagtggcttgagagacaagttaactg |
2758657 |
T |
 |
| Q |
115 |
gaaaaggaatttaggtaaggatcatgtttttgttttggggaaaatttcttgggattttagaaggactagtgattctccttggggaagtagattgttagag |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
2758656 |
gaaaaggaatttaggtaaggatcatgtttttgttttggggaaaatttcttgggattttagaaggactagtgattctccttggggaactagattgttagag |
2758557 |
T |
 |
| Q |
215 |
ctcgaaaaacttcaaaatcc |
234 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
2758556 |
ctcgaaaaacttcaaaatcc |
2758537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 17 - 234
Target Start/End: Complemental strand, 2754793 - 2754576
Alignment:
| Q |
17 |
cttgatgtgctgagatggcatttccagaatgtttcaaatgatgttaaagacagtttaagtttggaattagttaagtggcttgagagacaagttaactgga |
116 |
Q |
| |
|
||||||||| |||||||||||||| | ||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||| |||||||| |||| |
|
|
| T |
2754793 |
cttgatgtgttgagatggcatttcaaaaatgtttcaaatgatgttaaagatagtttaggtttggaattagttaagtggcttgagaaacaagttacatgga |
2754694 |
T |
 |
| Q |
117 |
aaaggaatttaggtaaggatcatgtttttgttttggggaaaatttcttgggattttagaaggactagtgattctccttggggaagtagattgttagagct |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
2754693 |
aaaggaatttaggtaaggatcatgtttttgttttagggaaaatttcttgggattttagaaggactagtgattctccttggggaactagattgttaaagct |
2754594 |
T |
 |
| Q |
217 |
cgaaaaacttcaaaatcc |
234 |
Q |
| |
|
||| || |||||||||| |
|
|
| T |
2754593 |
cgatgaatttcaaaatcc |
2754576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 51; Significance: 2e-20; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 145 - 223
Target Start/End: Original strand, 18300061 - 18300139
Alignment:
| Q |
145 |
tgttttggggaaaatttcttgggattttagaaggactagtgattctccttggggaagtagattgttagagctcgaaaaa |
223 |
Q |
| |
|
||||||||||||||| || |||||||||||||||||| |||||||||||||||| ||||||||||||||| |||||| |
|
|
| T |
18300061 |
tgttttggggaaaatctcatgggattttagaaggactgacgattctccttggggaactagattgttagagcttgaaaaa |
18300139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0019 (Bit Score: 50; Significance: 9e-20; HSPs: 1)
Name: scaffold0019
Description:
Target: scaffold0019; HSP #1
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 145 - 234
Target Start/End: Complemental strand, 60855 - 60766
Alignment:
| Q |
145 |
tgttttggggaaaatttcttgggattttagaaggactagtgattctccttggggaagtagattgttagagctcgaaaaacttcaaaatcc |
234 |
Q |
| |
|
||||||||||||||| || ||||||||||||||||| |||||||||||||||| ||||||||||||||| |||||| | |||||||| |
|
|
| T |
60855 |
tgttttggggaaaatatcaagggattttagaaggactgacgattctccttggggaactagattgttagagcttgaaaaattgcaaaatcc |
60766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University