View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1802_low_48 (Length: 233)
Name: NF1802_low_48
Description: NF1802
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1802_low_48 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 78; Significance: 2e-36; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 1 - 82
Target Start/End: Complemental strand, 19414079 - 19413998
Alignment:
| Q |
1 |
ttttcataacactccctgttgatgccatgcccaagttcaaggaagaaatggaagcgcttaatgtttcttaattgaacttctg |
82 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
19414079 |
ttttcataacactccctgttgatgccatgcccaagttcaaggaagaaatggaagcgcttaatgtttcttaattgaacctctg |
19413998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 35; Significance: 0.00000000008; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 1 - 55
Target Start/End: Complemental strand, 27069343 - 27069289
Alignment:
| Q |
1 |
ttttcataacactccctgttgatgccatgcccaagttcaaggaagaaatggaagc |
55 |
Q |
| |
|
|||||| | |||||||||||||||||||||| ||||||||||| ||||| ||||| |
|
|
| T |
27069343 |
ttttcacatcactccctgttgatgccatgcctaagttcaaggacgaaattgaagc |
27069289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 9 - 55
Target Start/End: Complemental strand, 27098060 - 27098014
Alignment:
| Q |
9 |
acactccctgttgatgccatgcccaagttcaaggaagaaatggaagc |
55 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||| ||||| ||||| |
|
|
| T |
27098060 |
acactccctgttgctgccatgcccaagttcaaggaggaaattgaagc |
27098014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 9 - 55
Target Start/End: Complemental strand, 27105059 - 27105013
Alignment:
| Q |
9 |
acactccctgttgatgccatgcccaagttcaaggaagaaatggaagc |
55 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||| ||||| ||||| |
|
|
| T |
27105059 |
acactccctgttgctgccatgcccaagttcaaggaggaaattgaagc |
27105013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University