View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18030_high_6 (Length: 347)
Name: NF18030_high_6
Description: NF18030
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18030_high_6 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 104; Significance: 8e-52; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 104; E-Value: 8e-52
Query Start/End: Original strand, 55 - 166
Target Start/End: Original strand, 5676921 - 5677032
Alignment:
| Q |
55 |
atagatttgttatttctaacgattaacttgattgagttagggttttaaatcaattttagttcttttgttttacaaatcaaaacacgtgatctattgtttc |
154 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5676921 |
atagatttgttatttctaacgattagcttgattgagttagggttttaaatcaattttggttcttttgttttacaaatcaaaacacgtgatctattgtttc |
5677020 |
T |
 |
| Q |
155 |
tttcacttgaac |
166 |
Q |
| |
|
|||||||||||| |
|
|
| T |
5677021 |
tttcacttgaac |
5677032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 268 - 322
Target Start/End: Original strand, 5677042 - 5677096
Alignment:
| Q |
268 |
agtgtcattgtttccatgtttaattttgttatttttggtaacagcacaatacata |
322 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
5677042 |
agtgtcattgtttccatgtttaattttgttatttttggtaacagcacagtacata |
5677096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University