View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18030_low_7 (Length: 377)
Name: NF18030_low_7
Description: NF18030
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18030_low_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 333; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 333; E-Value: 0
Query Start/End: Original strand, 20 - 364
Target Start/End: Complemental strand, 50539593 - 50539249
Alignment:
| Q |
20 |
agaagcccatctttgtatatagcttatagggtaagatgatgagaaaaggccatcatatacaaaaagctaaacggtactactagctatgctcttgtaatca |
119 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50539593 |
agaagcccatcttcgtatatagcttatagggtaagatgatgagaaaaggccatcatatacaaaaagctaaacggtactactagctatgctcttgtaatca |
50539494 |
T |
 |
| Q |
120 |
tgttgcttgctttttcatactgaatgtattgtgtcatgtcatggggcaatcataacacaaagttaattttcatctcttctaattaatcaacttacgtgat |
219 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50539493 |
tgttgcttgctttttcatacttaatgtattgtgtcatgtcatggggcaatcataacacaaagttaattttcatctcttctaattaatcaacttacgtgat |
50539394 |
T |
 |
| Q |
220 |
cttgtctccctttccccataaagtctctatagagttggaaaagaagagattgatcacaacatgcaagctaagcattgtaacaattaaggcaaaaccctaa |
319 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50539393 |
cttgtctccctttccccataaagtctctatagagttggaaaagaagagattgatcacaacatgcaagctaagcattgtaacaattaaggcaaaaccctaa |
50539294 |
T |
 |
| Q |
320 |
ccctaaaaatattggttaatttttccaccatgaacaagaataatc |
364 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
50539293 |
ccctaaaaatattggttaatttttccaccatgaacaagaacaatc |
50539249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University