View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18031_low_10 (Length: 274)
Name: NF18031_low_10
Description: NF18031
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18031_low_10 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 16 - 250
Target Start/End: Complemental strand, 453511 - 453277
Alignment:
| Q |
16 |
atccagatgatagaccaacaatggaaagaattgtttcatatctgagtaatgtttcagttgagttaccattgcctcaagagcctggaggtttcatgggtaa |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
453511 |
atccagatgatagaccaacaatggaaagaattgtttcatatctgagtaatgtttcagttgagttaccattgcctcaagagcctggaggtttcatgggtaa |
453412 |
T |
 |
| Q |
116 |
tagaacgaatcaaataccaagggataatatttcggatcaacgtaataatagcaatactacgggatcctcagtcaatgatatcaccatgaataattctttt |
215 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
453411 |
tagaacgaatcaaataccaagggataacatttcggatcaacgtaataatagcaatactacgggatcctcagtcaatgatatcaccatgaataattctttt |
453312 |
T |
 |
| Q |
216 |
cctagatagcttgacaatcatcatcttacaaacta |
250 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| |
|
|
| T |
453311 |
cctagatagcttgacaatcatcttcttacaaacta |
453277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 21 - 58
Target Start/End: Complemental strand, 10401116 - 10401079
Alignment:
| Q |
21 |
gatgatagaccaacaatggaaagaattgtttcatatct |
58 |
Q |
| |
|
||||||||||||||||||| || ||||||||||||||| |
|
|
| T |
10401116 |
gatgatagaccaacaatggtaacaattgtttcatatct |
10401079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University