View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18031_low_10 (Length: 274)

Name: NF18031_low_10
Description: NF18031
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18031_low_10
NF18031_low_10
[»] chr5 (1 HSPs)
chr5 (16-250)||(453277-453511)
[»] chr8 (1 HSPs)
chr8 (21-58)||(10401079-10401116)


Alignment Details
Target: chr5 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 16 - 250
Target Start/End: Complemental strand, 453511 - 453277
Alignment:
16 atccagatgatagaccaacaatggaaagaattgtttcatatctgagtaatgtttcagttgagttaccattgcctcaagagcctggaggtttcatgggtaa 115  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
453511 atccagatgatagaccaacaatggaaagaattgtttcatatctgagtaatgtttcagttgagttaccattgcctcaagagcctggaggtttcatgggtaa 453412  T
116 tagaacgaatcaaataccaagggataatatttcggatcaacgtaataatagcaatactacgggatcctcagtcaatgatatcaccatgaataattctttt 215  Q
    ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
453411 tagaacgaatcaaataccaagggataacatttcggatcaacgtaataatagcaatactacgggatcctcagtcaatgatatcaccatgaataattctttt 453312  T
216 cctagatagcttgacaatcatcatcttacaaacta 250  Q
    |||||||||||||||||||||| ||||||||||||    
453311 cctagatagcttgacaatcatcttcttacaaacta 453277  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 21 - 58
Target Start/End: Complemental strand, 10401116 - 10401079
Alignment:
21 gatgatagaccaacaatggaaagaattgtttcatatct 58  Q
    ||||||||||||||||||| || |||||||||||||||    
10401116 gatgatagaccaacaatggtaacaattgtttcatatct 10401079  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University