View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18031_low_14 (Length: 239)
Name: NF18031_low_14
Description: NF18031
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18031_low_14 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 115; Significance: 2e-58; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 68 - 223
Target Start/End: Original strand, 18647691 - 18647842
Alignment:
| Q |
68 |
aatggaaattggagcatgtggtattcatggtaattggatactttttattttggaaacctggagaataaggaaattaattgttattaattaaagagacggt |
167 |
Q |
| |
|
||||||||||| || |||||| | |||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
18647691 |
aatggaaattgaagtatgtggcactcatggtaattggatactttttattttgaaaacctggagaataaggaaatt----gttattaattaaagagacggt |
18647786 |
T |
 |
| Q |
168 |
gttgattttattgtcgaaggatttgaactcgatatgtcttgtgtcacacctcattg |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
18647787 |
gttgattttattgtcgaaggatttgaactcgatatgtcttatgtcacacctcattg |
18647842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University