View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18031_low_7 (Length: 359)
Name: NF18031_low_7
Description: NF18031
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18031_low_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 157; Significance: 2e-83; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 177 - 349
Target Start/End: Complemental strand, 25120369 - 25120198
Alignment:
| Q |
177 |
gatagctaaataactcaagtttcaataataatattattggatttattttttgacaaaatattattggattttaatagtacctacctataagacttcttat |
276 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25120369 |
gatagctaaataactcaagtttcaataataatattattggattt-ttttttgacaaaatattattggattttaatagtacctacctataagacttcttat |
25120271 |
T |
 |
| Q |
277 |
aaatttagatactattattcccgtgagcttagctcagtttgcaggataatgcttaatatatggaaggtctgtg |
349 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
25120270 |
aaatttagatactattatccccgtgagcttagctcagtttgcaggataatgcgtaatatatggaaggtctgtg |
25120198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 17 - 118
Target Start/End: Complemental strand, 25120529 - 25120428
Alignment:
| Q |
17 |
atagggttgtttttggattgaaccacacatagagttccactttttgcaaagctctcctacttgtacattctgttaaaatataaaacaagagataagtttc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25120529 |
atagggttgtttttggattgaaccacacatagagttccactttttgcaaagctctcctacttgtacattctgttaaaatataaaacaagagataagtttc |
25120430 |
T |
 |
| Q |
117 |
ac |
118 |
Q |
| |
|
|| |
|
|
| T |
25120429 |
ac |
25120428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 292 - 347
Target Start/End: Complemental strand, 30639494 - 30639438
Alignment:
| Q |
292 |
tattcccgtgagcttagctcagtttgcagg-ataatgcttaatatatggaaggtctg |
347 |
Q |
| |
|
|||||||||||| ||||||||||| | ||| ||||||| ||||||||| |||||||| |
|
|
| T |
30639494 |
tattcccgtgagtttagctcagttggtaggaataatgcataatatatgcaaggtctg |
30639438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University