View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18033_low_14 (Length: 421)
Name: NF18033_low_14
Description: NF18033
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18033_low_14 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 302; Significance: 1e-170; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 302; E-Value: 1e-170
Query Start/End: Original strand, 67 - 404
Target Start/End: Original strand, 1673517 - 1673855
Alignment:
| Q |
67 |
aatagtatcggagtcctagttcgacttgatggaaaagcaggggaagcgggaacttggctttagaagtttatagacgccacatctataatttattatgttg |
166 |
Q |
| |
|
|||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1673517 |
aataatatcagagtcctagttcgacttgatggaaaagcaggggaagcgggaacttggctttagaagtttatagacgccacatctataatttattatgttg |
1673616 |
T |
 |
| Q |
167 |
gttttgggacaggtgttttatctaaccttgaaagtttaaattagagatgtgagatgtccatgttattcttgtttttgtttttatacgttttgtatttact |
266 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1673617 |
gttttgggacaggtgttttatctaaccttgaaagtttaaattagagatgtgagatgtccatgttattcttgtttttgtttttatacgttttgtatttact |
1673716 |
T |
 |
| Q |
267 |
taattaat-nnnnnnntggaacatagaagaagatgcatcatgtaaccgcttcatgaatagacaatccgcaaacattgcattccaaatccatgttgtgttg |
365 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1673717 |
taattaataaaaaaaatggaacatagaagaagatgcatcatgtaaccgcttcatgaatagacaatccgcaaacattgcattccaaatccatgttgtgttg |
1673816 |
T |
 |
| Q |
366 |
agttggccttatcttgtcatctttgctcaccgtcttcat |
404 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1673817 |
agttggccttatcttgtcatctttgctcaccgtcttcat |
1673855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 10 - 64
Target Start/End: Original strand, 1673394 - 1673448
Alignment:
| Q |
10 |
aagaatatgtcagtacatcaagaatattagagaggaagatgtcatatcttcacct |
64 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
1673394 |
aagaatatgtcaatacatcaagaatattagagaggaagatgtaatatcttcacct |
1673448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University